Skip to content

Add extra column Hgvs_Offset and extend Additional_Transcripts #301

New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Merged
leexgh merged 7 commits into from
Aug 10, 2026
Merged

Add extra column Hgvs_Offset and extend Additional_Transcripts #301

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
7 commits
Select commit Hold shift + click to select a range
1470d83
Add category for error messages
leexgh Jun 15, 2026
7e0d708
update comments
leexgh Jun 22, 2026
f5fa4cc
Add refseq to additional_transcript column
leexgh Jul 2, 2026
0aafdc7
Add HGVS_Offset extended-mode column; fix stale test fixture
leexgh Jul 24, 2026
3ec0179
Regenerate test fixtures for www.genomenexus.org v2.2.1 upgrade
leexgh Jul 25, 2026
bc7ea94
Ignore first row in tests - no need to compare genome nexus versions
leexgh Aug 5, 2026
1af7c16
Update testing output file as we moved 'splice_region' out of splice …
leexgh Aug 6, 2026
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
26 changes: 13 additions & 13 deletions .circleci/config.yml
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -47,36 +47,36 @@ jobs:
# run test
- run:
name: "check if maf file still the same when annotating with uniprot transcripts"
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/data_mutations_extended_100.in.txt --output-filename test/data/data_mutations_extended_100.out.uniprot.txt --isoform-override uniprot && git diff -G "^[^#]" --exit-code test/data/data_mutations_extended_100.out.uniprot.txt || (echo MAF uniprot output changed test/data/data_mutations_extended_100.out.uniprot.txt && exit 1)'
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/data_mutations_extended_100.in.txt --output-filename test/data/data_mutations_extended_100.out.uniprot.txt --isoform-override uniprot && diff <(tail -n +2 test/data/data_mutations_extended_100.out.uniprot.txt) <(git show HEAD:test/data/data_mutations_extended_100.out.uniprot.txt | tail -n +2) || (echo MAF uniprot output changed test/data/data_mutations_extended_100.out.uniprot.txt && exit 1)'

- run:
name: "check if maf file still the same when annotating with mskcc transcripts"
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/data_mutations_extended_100.in.txt --output-filename test/data/data_mutations_extended_100.out.mskcc.txt --isoform-override mskcc && git diff -G "^[^#]" --exit-code test/data/data_mutations_extended_100.out.mskcc.txt || (echo MAF mskcc output changed test/data/data_mutations_extended_100.out.mskcc.txt && exit 1)'
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/data_mutations_extended_100.in.txt --output-filename test/data/data_mutations_extended_100.out.mskcc.txt --isoform-override mskcc && diff <(tail -n +2 test/data/data_mutations_extended_100.out.mskcc.txt) <(git show HEAD:test/data/data_mutations_extended_100.out.mskcc.txt | tail -n +2) || (echo MAF mskcc output changed test/data/data_mutations_extended_100.out.mskcc.txt && exit 1)'

# run test
- run:
name: "check if minimal example maf file still the same when annotating with mskcc transcripts"
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/minimal_example.in.txt --output-filename test/data/minimal_example.out.mskcc.txt --isoform-override mskcc && git diff -G "^[^#]" --exit-code test/data/minimal_example.out.mskcc.txt || (echo simple MAF mskcc output changed test/data/minimal_example.out.mskcc.txt && exit 1)'
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/minimal_example.in.txt --output-filename test/data/minimal_example.out.mskcc.txt --isoform-override mskcc && diff <(tail -n +2 test/data/minimal_example.out.mskcc.txt) <(git show HEAD:test/data/minimal_example.out.mskcc.txt | tail -n +2) || (echo simple MAF mskcc output changed test/data/minimal_example.out.mskcc.txt && exit 1)'

- run:
name: "check if columns prefixed by IGNORE_Genome_Nexus_Original are immutable"
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/immutable_columns_test.in.txt --output-filename test/data/immutable_columns_test.out.uniprot.txt --isoform-override uniprot && git diff -G "^[^#]" --exit-code test/data/immutable_columns_test.out.uniprot.txt || (echo simple MAF uniprot output changed test/data/immutable_columns_test.out.uniprot.txt && exit 1)'
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/immutable_columns_test.in.txt --output-filename test/data/immutable_columns_test.out.uniprot.txt --isoform-override uniprot && diff <(tail -n +2 test/data/immutable_columns_test.out.uniprot.txt) <(git show HEAD:test/data/immutable_columns_test.out.uniprot.txt | tail -n +2) || (echo simple MAF uniprot output changed test/data/immutable_columns_test.out.uniprot.txt && exit 1)'

- run:
name: "check if corner cases example maf file still the same when annotating with uniprot transcripts"
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/corner_cases.two_tumor_seq_allele.in.txt --output-filename test/data/corner_cases.two_tumor_seq_allele.out.uniprot.txt --isoform-override uniprot && git diff -G "^[^#]" --exit-code test/data/corner_cases.two_tumor_seq_allele.out.uniprot.txt || (echo simple MAF uniprot output changed test/data/corner_cases.two_tumor_seq_allele.out.uniprot.txt && exit 1)'
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/corner_cases.two_tumor_seq_allele.in.txt --output-filename test/data/corner_cases.two_tumor_seq_allele.out.uniprot.txt --isoform-override uniprot && diff <(tail -n +2 test/data/corner_cases.two_tumor_seq_allele.out.uniprot.txt) <(git show HEAD:test/data/corner_cases.two_tumor_seq_allele.out.uniprot.txt | tail -n +2) || (echo simple MAF uniprot output changed test/data/corner_cases.two_tumor_seq_allele.out.uniprot.txt && exit 1)'

- run:
name: "check if corner cases example maf file still the same when annotating with mskcc transcripts"
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/corner_cases.two_tumor_seq_allele.in.txt --output-filename test/data/corner_cases.two_tumor_seq_allele.out.mskcc.txt --isoform-override mskcc && git diff -G "^[^#]" --exit-code test/data/corner_cases.two_tumor_seq_allele.out.mskcc.txt || (echo simple MAF mskcc output changed test/data/corner_cases.two_tumor_seq_allele.out.mskcc.txt && exit 1)'
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/corner_cases.two_tumor_seq_allele.in.txt --output-filename test/data/corner_cases.two_tumor_seq_allele.out.mskcc.txt --isoform-override mskcc && diff <(tail -n +2 test/data/corner_cases.two_tumor_seq_allele.out.mskcc.txt) <(git show HEAD:test/data/corner_cases.two_tumor_seq_allele.out.mskcc.txt | tail -n +2) || (echo simple MAF mskcc output changed test/data/corner_cases.two_tumor_seq_allele.out.mskcc.txt && exit 1)'

- run:
name: "check if corner cases example maf file still the same when annotating with uniprot transcripts"
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/corner_cases.in.txt --output-filename test/data/corner_cases.out.uniprot.txt --isoform-override uniprot && git diff -G "^[^#]" --exit-code test/data/corner_cases.out.uniprot.txt || (echo simple MAF uniprot output changed test/data/corner_cases.out.uniprot.txt && exit 1)'
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/corner_cases.in.txt --output-filename test/data/corner_cases.out.uniprot.txt --isoform-override uniprot && diff <(tail -n +2 test/data/corner_cases.out.uniprot.txt) <(git show HEAD:test/data/corner_cases.out.uniprot.txt | tail -n +2) || (echo simple MAF uniprot output changed test/data/corner_cases.out.uniprot.txt && exit 1)'

- run:
name: "check if corner cases example maf file still the same when annotating with mskcc transcripts"
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/corner_cases.in.txt --output-filename test/data/corner_cases.out.mskcc.txt --isoform-override mskcc && git diff -G "^[^#]" --exit-code test/data/corner_cases.out.mskcc.txt || (echo simple MAF mskcc output changed test/data/corner_cases.out.mskcc.txt && exit 1)'
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/corner_cases.in.txt --output-filename test/data/corner_cases.out.mskcc.txt --isoform-override mskcc && diff <(tail -n +2 test/data/corner_cases.out.mskcc.txt) <(git show HEAD:test/data/corner_cases.out.mskcc.txt | tail -n +2) || (echo simple MAF mskcc output changed test/data/corner_cases.out.mskcc.txt && exit 1)'

# - run:
# name: "Run vcf2maf test cases"
Expand All @@ -85,23 +85,23 @@ jobs:
# run test
- run:
name: "check if maf file still the same when annotating with uniprot transcripts and POSTs"
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/data_mutations_extended_100.in.txt --output-filename test/data/data_mutations_extended_100.out.post.uniprot.txt --isoform-override uniprot && git diff -G "^[^#]" --exit-code test/data/data_mutations_extended_100.out.uniprot.txt || (echo MAF uniprot output changed test/data/data_mutations_extended_100.out.uniprot.txt)'
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/data_mutations_extended_100.in.txt --output-filename test/data/data_mutations_extended_100.out.post.uniprot.txt --isoform-override uniprot && diff <(tail -n +2 test/data/data_mutations_extended_100.out.post.uniprot.txt) <(git show HEAD:test/data/data_mutations_extended_100.out.uniprot.txt | tail -n +2) || (echo MAF uniprot output changed test/data/data_mutations_extended_100.out.uniprot.txt)'

- run:
name: "check if maf file still the same when annotating with mskcc transcripts and POSTs"
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/data_mutations_extended_100.in.txt --output-filename test/data/data_mutations_extended_100.out.post.mskcc.txt --isoform-override mskcc && git diff -G "^[^#]" --exit-code test/data/data_mutations_extended_100.out.mskcc.txt || (echo MAF mskcc output changed test/data/data_mutations_extended_100.out.mskcc.txt)'
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/data_mutations_extended_100.in.txt --output-filename test/data/data_mutations_extended_100.out.post.mskcc.txt --isoform-override mskcc && diff <(tail -n +2 test/data/data_mutations_extended_100.out.post.mskcc.txt) <(git show HEAD:test/data/data_mutations_extended_100.out.mskcc.txt | tail -n +2) || (echo MAF mskcc output changed test/data/data_mutations_extended_100.out.mskcc.txt)'

- run:
name: "check if minimal example maf file still the same when annotating with mskcc transcripts and POSTs"
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/minimal_example.in.txt --output-filename test/data/minimal_example.out.post.mskcc.txt --isoform-override mskcc && git diff -G "^[^#]" --exit-code test/data/minimal_example.out.mskcc.txt || (echo simple MAF mskcc output changed test/data/minimal_example.out.mskcc.txt)'
command: 'java -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/minimal_example.in.txt --output-filename test/data/minimal_example.out.post.mskcc.txt --isoform-override mskcc && diff <(tail -n +2 test/data/minimal_example.out.post.mskcc.txt) <(git show HEAD:test/data/minimal_example.out.mskcc.txt | tail -n +2) || (echo simple MAF mskcc output changed test/data/minimal_example.out.mskcc.txt)'

- run:
name: "check if my_variant_info provides gnomad annotations"
command: 'java -Dgenomenexus.enrichment_fields=annotation_summary,my_variant_info -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/my_variant_info_corner_cases.in.txt --output-filename test/data/my_variant_info_corner_cases.out.uniprot.txt --isoform-override uniprot && git diff -G "^[^#]" --exit-code test/data/my_variant_info_corner_cases.out.uniprot.txt || (echo simple MAF uniprot output changed test/data/my_variant_info_corner_cases.out.uniprot.txt)'
command: 'java -Dgenomenexus.enrichment_fields=annotation_summary,my_variant_info -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/my_variant_info_corner_cases.in.txt --output-filename test/data/my_variant_info_corner_cases.out.uniprot.txt --isoform-override uniprot && diff <(tail -n +2 test/data/my_variant_info_corner_cases.out.uniprot.txt) <(git show HEAD:test/data/my_variant_info_corner_cases.out.uniprot.txt | tail -n +2) || (echo simple MAF uniprot output changed test/data/my_variant_info_corner_cases.out.uniprot.txt)'

- run:
name: "check if nucleotide_context provides Ref_Tri and Var_Tri columnsj"
command: 'java -Dgenomenexus.enrichment_fields=annotation_summary,nucleotide_context -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/data_mutations_extended_100.in.txt --output-filename test/data/data_mutations_extended_100.out.uniprot.nucleotide_context.txt --isoform-override uniprot && git diff -G "^[^#]" --exit-code test/data/data_mutations_extended_100.out.uniprot.nucleotide_context.txt || (echo simple MAF uniprot output changed test/data/data_mutations_extended_100.out.uniprot.nucleotide_context.txt)'
command: 'java -Dgenomenexus.enrichment_fields=annotation_summary,nucleotide_context -jar annotationPipeline/target/annotationPipeline-*.jar --filename test/data/data_mutations_extended_100.in.txt --output-filename test/data/data_mutations_extended_100.out.uniprot.nucleotide_context.txt --isoform-override uniprot && diff <(tail -n +2 test/data/data_mutations_extended_100.out.uniprot.nucleotide_context.txt) <(git show HEAD:test/data/data_mutations_extended_100.out.uniprot.nucleotide_context.txt | tail -n +2) || (echo simple MAF uniprot output changed test/data/data_mutations_extended_100.out.uniprot.nucleotide_context.txt)'

- run:
name: "performance benchmark: annotate CHOL TCGA GDC (~3764 variants) against grch38.genomenexus.org"
Expand Down
5 changes: 3 additions & 2 deletions README.md
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -73,7 +73,7 @@ docker run -v ${PWD}:/wd genomenexus/gn-annotation-pipeline:latest java -jar ann
| `-a` | `--add-original-genomic-location` | Add original genomic location data columns into the output, name columns with prefix 'IGNORE_Genome_Nexus_Original_'. This would be useful if saving a reference of original input is needed and won't be changed in any condition|
| `-d` | `--ignore-original-location` | Genome-nexus-annotation-pipeline reads original genomic location info as input by default, if not existing, reading from normal genomic location info columns. Adding `-d` ignores original genomic location info columns (columns with prefix 'IGNORE_Genome_Nexus_Original_') and only use whatever in normal genomic location info columns. This would be helpful if you'd like to stick with current genomic location info columns.|
| `-n` | `--note-column` | Add 'Genomic Location Explanation' column for variants that have altered genomic location|
| `-m` | `--mode` | Mode of annotation (currently only accepts `extended` to include `Additional_Transcripts` column)|
| `-m` | `--mode` | Mode of annotation (currently only accepts `extended` to include `Additional_Transcripts` and `HGVS_Offset` columns)|

### Reference Genome
The Genome Nexus Annotation Pipeline supports two versions of the human genome reference assembly:
Expand Down Expand Up @@ -138,7 +138,8 @@ docker run -e GENOMENEXUS_BASE=https://grch38.genomenexus.org -v ${PWD}:/wd geno
|Protein_position|VEP||
|Codons|VEP||
|Exon_Number|VEP||
|Additional_Transcripts||Contains a semicolon-separated list of alternate transcripts. Each entry is a comma-separated list of: Transcript ID, Hugo Gene Symbol, HGVSp Short, HGVSc, Variant Classification. **Requires `-m extended` / `--mode extended` flag**|
|Additional_Transcripts||Contains a semicolon-separated list of alternate transcripts. Each entry is a comma-separated list of: Transcript ID, RefSeq, Hugo Gene Symbol, HGVSp Short, HGVSc, Variant Classification. **Requires `-m extended` / `--mode extended` flag**|
|HGVS_Offset|VEP|The `hgvs_offset` value of the canonical transcript, as reported by Genome Nexus. **Requires `-m extended` / `--mode extended` flag**|
|gnomAD_AF|myvariant.info|Need to add "my_variant_info" in "genomenexus.enrichment_fields"|
|gnomAD_AFR_AF|myvariant.info|Need to add "my_variant_info" in "genomenexus.enrichment_fields"|
|gnomAD_AMR_AF|myvariant.info|Need to add "my_variant_info" in "genomenexus.enrichment_fields"|
Expand Down
4 changes: 2 additions & 2 deletions annotationPipeline/src/test/resources/expected/corner_cases.mskcc.txt
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,5 +1,5 @@
#genome_nexus_version: 1.0.2
#genome_nexus_version: 2.2.1
#isoform: mskcc
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number genomic_location_explanation Annotation_Status
MET 4233 GRCh37 7 116411872 116411900 + splice_region_variant,intron_variant Splice_Region DEL TAACAAGCTCTTTCTTTCTCTCTGTTTTA - - ENST00000397752.3:c.2888-31_2888-3del p.X963_splice ENST00000397752 NM_000245.2 963 SUCCESS
MET 4233 GRCh37 7 116411872 116411900 + splice_region_variant,intron_variant Splice_Region DEL TAACAAGCTCTTTCTTTCTCTCTGTTTTA - - ENST00000397752.3:c.2888-31_2888-3del p.*963* ENST00000397752 NM_000245.2 SUCCESS
PCM1 5108 GRCh37 8 17796382 17796383 + missense_variant Missense_Mutation DNP AC GT GT rs754721723 ENST00000325083.8:c.476_477inv p.Asn159Ser p.N159S ENST00000325083 NM_006197.3 159 aAC/aGT 5/39 SUCCESS
4 changes: 2 additions & 2 deletions annotationPipeline/src/test/resources/expected/corner_cases.uniprot.txt
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,5 +1,5 @@
#genome_nexus_version: 1.0.2
#genome_nexus_version: 2.2.1
#isoform: uniprot
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number genomic_location_explanation Annotation_Status
MET 4233 GRCh37 7 116411872 116411900 + splice_region_variant,intron_variant Splice_Region DEL TAACAAGCTCTTTCTTTCTCTCTGTTTTA - - ENST00000397752.3:c.2888-31_2888-3del p.X963_splice ENST00000397752 NM_000245.2 963 SUCCESS
MET 4233 GRCh37 7 116411872 116411900 + splice_region_variant,intron_variant Splice_Region DEL TAACAAGCTCTTTCTTTCTCTCTGTTTTA - - ENST00000397752.3:c.2888-31_2888-3del p.*963* ENST00000397752 NM_000245.2 SUCCESS
PCM1 5108 GRCh37 8 17796382 17796383 + missense_variant Missense_Mutation DNP AC GT GT rs754721723 ENST00000325083.8:c.476_477inv p.Asn159Ser p.N159S ENST00000325083 NM_006197.3 159 aAC/aGT 5/39 SUCCESS
Loading