diff --git a/tools/vg/giraffe.xml b/tools/vg/giraffe.xml
index d99d69c326e..cfbc8385826 100644
--- a/tools/vg/giraffe.xml
+++ b/tools/vg/giraffe.xml
@@ -1,10 +1,10 @@
-<tool id="vg_giraffe" name="vg giraffe" version="@TOOL_VERSION_GIRAFFE@+galaxy@VERSION_SUFFIX_GIRAFFE@" profile="@PROFILE@">
+<tool id="vg_giraffe" name="vg giraffe" version="@TOOL_VERSION_ADDITION@+galaxy@VERSION_SUFFIX_ADDITION@" profile="@PROFILE@">
     <description>is a fast haplotype-aware read mapper</description>
     <macros>
         <import>macros.xml</import>
     </macros>
     <requirements>
-        <requirement type="package" version="@TOOL_VERSION_GIRAFFE@">vg</requirement>
+        <requirement type="package" version="@TOOL_VERSION_ADDITION@">vg</requirement>
         <requirement type="package" version="1.23.1">samtools</requirement>
     </requirements>
     <command detect_errors="aggressive"><![CDATA[
diff --git a/tools/vg/macros.xml b/tools/vg/macros.xml
index a112880a91a..dd34108b5e9 100644
--- a/tools/vg/macros.xml
+++ b/tools/vg/macros.xml
@@ -5,9 +5,9 @@
         </requirements>
     </xml>
     <token name="@TOOL_VERSION@">1.23.0</token>  
-    <token name="@TOOL_VERSION_GIRAFFE@">1.73.0</token>  
-    <token name="@VERSION_SUFFIX_GIRAFFE@">0</token>
-    <token name="@PROFILE@">26.1</token>
+    <token name="@TOOL_VERSION_ADDITION@">1.73.0</token>  
+    <token name="@VERSION_SUFFIX_ADDITION@">0</token>
+    <token name="@PROFILE@">26.0</token>
     <xml name="param_xg_name_for_htslib">
         <param argument="--xg-name" type="data" format="xg" optional="true" label="XG Graph" help="Writing the alignments in SAM, BAM, or CRAM format can have poor performance. Specify a XG graph that is compatible with the input graph to avoid that. This is mandatory if your input GBZ or GBWTGraph is missing reference paths for surjection (e.g., if it was created with a vg version older than 1.37.0). This option is ignored if the input graph is already an XG graph"/>
     </xml>
diff --git a/tools/vg/paths.xml b/tools/vg/paths.xml
new file mode 100644
index 00000000000..e16a36dadb3
--- /dev/null
+++ b/tools/vg/paths.xml
@@ -0,0 +1,619 @@
+<tool id="vg_paths" name="vg paths" version="@TOOL_VERSION_ADDITION@+galaxy@VERSION_SUFFIX_ADDITION@" profile="@PROFILE@">
+    <description>extracts and analyzes paths in a variation graph</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <requirements>
+        <requirement type="package" version="@TOOL_VERSION_ADDITION@">vg</requirement>
+    </requirements>
+    <command detect_errors="aggressive"><![CDATA[
+        vg paths
+
+            ## Input Graph
+            --xg '$input_op.xg'
+            #if $input_op.gbwt:
+                --gbwt '$input_op.gbwt'
+            #end if
+
+            ## Path Selection
+            #if $selection_con.selector_op == "file":
+                --paths-file '$selection_con.paths_file'
+            #elif $selection_con.selector_op == "prefix":
+                --paths-by '$selection_con.paths_by'
+            #elif $selection_con.selector_op == "sample":
+                --sample '$selection_con.sample'
+            #elif $selection_con.selector_op == "sense":
+                $selection_con.generic_paths
+                $selection_con.reference_paths
+                $selection_con.haplotype_paths
+            #elif $selection_con.selector_op == "alt":
+                --variant-paths
+            #end if
+            #if $exclude_sample:
+                --exclude-sample '$exclude_sample'
+            #end if
+
+            ## Output Type
+            #if $output_con.type == "graph":
+                #if $output_con.graph_con.graph_op == "extract":
+                    --extract-vg 
+                #elif $output_con.graph_con.graph_op == "drop":
+                    --drop-paths
+                #elif $output_con.graph_con.graph_op == "retain":
+                    --retain-paths 
+                #elif $output_con.graph_con.graph_op == "normalize":
+                    --normalize-paths
+                #elif $output_con.graph_con.graph_op == "augref":
+                    --compute-augref
+                    --min-augref-len $output_con.graph_con.min_augref_len
+                    #if $output_con.graph_con.augref_sample:
+                        --augref-sample '$output_con.graph_con.augref_sample'
+                    #end if
+                    #if $output_con.graph_con.augref_segs:
+                        --augref-segs '$output_augref_segs'
+                    #end if
+                #end if
+            #elif $output_con.type == "data":
+                #if $output_con.data_op == "gam":
+                    --extract-gam
+                #elif $output_con.data_op == "gaf":
+                    --extract-gaf
+                #elif $output_con.data_op == "list":
+                    --list 
+                #elif $output_con.data_op == "lengths":
+                    --lengths  
+                #elif $output_con.data_op == "metadata":
+                    --metadata
+                #elif $output_con.data_op == "cyclicity":
+                    --cyclicity 
+                #elif $output_con.data_op == "fasta":
+                    --extract-fasta  
+                #elif $output_con.data_op == "coverage":
+                    --coverage
+                #end if
+            #end if
+
+            ## Advanced
+            $advanced.overlay
+
+            > '$output'
+    ]]></command>
+    <inputs>
+        <section name="input_op" title="Input Files" expanded="true">
+            <param name="xg" type="data" format="xg,gbz,vg" label="Input Graph"/>
+            <param argument="--gbwt" type="data" format="gbwt" optional="true" label="GBWT index" help="Use threads from this index instead of input graph paths. Note: When providing a GBWT index, tool functions are limited (read more in the help section below)"/>
+        </section>
+        <conditional name="selection_con">
+            <param name="selector_op" type="select" label="Path Selection" help="Filter the paths in your input graph.">
+                <option value="default" selected="true">Default (all paths)</option>
+                <option value="file">From file (--paths-file)</option>
+                <option value="prefix">By name prefix (--paths-by)</option>
+                <option value="sample">By sample name (--sample)</option>
+                <option value="sense">By path sense</option>
+                <option value="alt">Variant paths (added by 'vg construct -a') (--variant-paths)</option>
+            </param>
+            <when value="default"/>
+            <when value="file">
+                <param name="paths_file" type="data" format="txt" label="File with path names" help="A text file containing one path name per line. Only paths matching these exact names will be selected"/>
+            </when>
+            <when value="prefix">
+                <param name="paths_by" type="text" optional="false" label="Path name prefix" help="Select all paths that start with this specific value"/>
+            </when>
+            <when value="sample">
+                <param name="sample" type="text" optional="false" label="Sample name" help="Extract only the haplotypes and reference paths that belong to this specific sample name"/>
+            </when>
+            <when value="sense">
+                <!-- Nicht auf GBWT-Dateien anwendbar sind. Sense filter werden bei gbwt ignoriert -->
+                <param name="generic_paths" type="boolean" truevalue="--generic-paths" falsevalue="" checked="true" label="Select generic paths (--generic-paths)"/>
+                <param name="reference_paths" type="boolean" truevalue="--reference-paths" falsevalue="" checked="true" label="Select reference paths (--reference-paths)"/>
+                <param name="haplotype_paths" type="boolean" truevalue="--haplotype-paths" falsevalue="" checked="true" label="Select haplotype paths (--haplotype-paths)" help="If none of the path senses are selected, then by default, all will be selected by the tool"/>
+            </when>
+            <!-- Not compatible with a gwbt index -->
+            <when value="alt"/>
+        </conditional>
+        <param argument="--exclude-sample" type="text" optional="true" label="Exclude from sample" help="Exclude paths belonging to this sample. Note: Cannot exclude the same sample when selecting paths by sample name"/>
+        <conditional name="output_con">
+            <param name="type" type="select" label="Output Type">
+                <option value="">Select an output type ...</option>
+                <option value="graph">Graph (in .vg format)</option>
+                <option value="data">Path Data</option>
+                <validator type="empty_field" message="You must select an output type"/>
+            </param>
+            <when value=""/>
+            <when value="graph">
+               <conditional name="graph_con">
+                    <param name="graph_op" type="select" label="Graph Operation">
+                        <option value="extract" selected="true">Output a path-only graph covering the selected paths (--extract-vg)</option> 
+                        <option value="drop">Output graph with the selected paths removed (--drop-paths)</option> 
+                        <option value="retain">Output graph with only the selected paths retained (--retain-paths)</option> 
+                        <option value="normalize">Output graph where equivalent paths in a site are merged (--normalize-paths)</option> 
+                        <option value="augref">Compute augmented reference path (--compute-augref)</option>
+                    </param>
+                    <when value="extract"/>
+                    <!-- Not compatible with a gwbt index -->
+                    <when value="drop"/>
+                    <!-- Not compatible with a gwbt index -->
+                    <when value="retain"/>
+                    <!-- Not compatible with a gwbt index -->
+                    <when value="normalize"/>
+                    <!-- Not compatible with a gwbt index -->
+                    <when value="augref">
+                        <param argument="--min-augref-len" type="integer" value="50" min="1" label="Minimum Augmented Reference Fragment Length" help="Minimum length for the newly created augmented paths" />
+                        <param argument="--augref-sample" type="text" optional="true" label="New Sample Name" help="Create augmented reference paths under a new sample name (copies base paths to new sample, then adds augmented reference paths). This prevents mixing artificial paths with your target sample. If unspecified, paths get added to your target sample" />
+                        <param argument="--augref-segs" type="boolean" truevalue="true" falsevalue="false" label="Output Augmented Reference Segments Table" help="Writes the segment definitions to an additional output tabular file" />
+                    </when>
+                </conditional>
+            </when>
+            <when value="data">
+                <param name="data_op" type="select" label="Data Format">
+                    <option value="gam" selected="true">Paths as GAM alignments (--extract-gam)</option> 
+                    <option value="gaf">Paths as GAF alignments (--extract-gaf)</option> 
+                    <option value="list">List of path names (--list)</option> 
+                    <option value="lengths">List of path names and their lengths (--lengths)</option> 
+                    <!-- Not compatible with a gwbt index -->
+                    <option value="metadata">List of path names and their metadata (--metadata)</option> 
+                    <option value="cyclicity">List of path names and their flag denoting the cyclicity (--cyclicity)</option> 
+                    <option value="fasta">Paths in FASTA format (--extract-fasta)</option> 
+                    <!-- Not compatible with a gwbt index -->
+                    <option value="coverage">Coverage statistics for paths (not including cycles) (--coverage)</option> 
+                </param>
+            </when>
+        </conditional>
+        <section name="advanced" title="Advanced" expanded="false">
+            <param argument="--overlay" type="boolean" truevalue="--overlay" falsevalue="" checked="false" label="Apply Reference Path Overlay" help="Builds a temporary, in-memory coordinate index for the graph. Enable this if your input graph does not support fast position lookups"/>
+        </section>
+    </inputs>
+    <outputs>
+        <data name="output" format="vg" label="${tool.name} on ${on_string}">
+            <change_format>
+                <when input="output_con.data_op" value="gam" format="gam"/>
+                <when input="output_con.data_op" value="gaf" format="gaf"/>
+                <when input="output_con.data_op" value="list" format="tabular"/>
+                <when input="output_con.data_op" value="lengths" format="tabular"/>
+                <when input="output_con.data_op" value="metadata" format="tabular"/>
+                <when input="output_con.data_op" value="cyclicity" format="tabular"/>
+                <when input="output_con.data_op" value="fasta" format="fasta"/>
+                <when input="output_con.data_op" value="coverage" format="tabular"/>
+            </change_format>
+        </data>
+        <data name="output_augref_segs" format="tabular" label="${tool.name} on ${on_string}: Augref Segments">
+            <filter>output_con['type'] == 'graph' and output_con['graph_con']['graph_op'] == 'augref' and output_con['graph_con']['augref_segs']</filter>
+        </data>
+    </outputs>
+    <tests>
+        <!-- Test Output Graph -->
+        <!-- Test 1: Tool default on a gbz graph. Output as path only graph -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="graph"/>
+                <conditional name="graph_con">
+                    <param name="graph_op" value="extract"/>
+                </conditional>
+            </conditional>
+            <output name="output" ftype="vg">
+                <assert_contents>
+                    <has_size min="11000"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 2: Run on a xg graph. Output with selected paths dropped -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="xy_with_alts.vg"/>
+            </conditional>
+            <conditional name="selection_con">
+                <param name="selector_op" value="alt"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="graph"/>
+                <conditional name="graph_con">
+                    <param name="graph_op" value="drop"/>
+                </conditional>
+            </conditional>
+            <output name="output" ftype="vg">
+                <assert_contents>
+                    <has_size min="9000"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 3: Run on a xg graph. Output with selected paths retained -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="xy_with_alts.vg"/>
+            </conditional>
+            <conditional name="selection_con">
+                <param name="selector_op" value="alt"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="graph"/>
+                <conditional name="graph_con">
+                    <param name="graph_op" value="retain"/>
+                </conditional>
+            </conditional>
+            <output name="output" ftype="vg">
+                <assert_contents>
+                    <has_size min="13000"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 4: Run on a xg graph. Output with selected paths normalized -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="xy_with_alts.vg"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="graph"/>
+                <conditional name="graph_con">
+                    <param name="graph_op" value="normalize"/>
+                </conditional>
+            </conditional>
+            <output name="output" ftype="vg">
+                <assert_contents>
+                    <has_size min="13000"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 5: Run on a xg graph. Output with Compute augmented reference path -->
+        <test expect_num_outputs="2">
+            <conditional name="input_op">
+                <param name="xg" value="xy_with_alts.vg"/>
+            </conditional>
+             <conditional name="selection_con">
+                <param name="selector_op" value="prefix"/>
+                <param name="paths_by" value="y"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="graph"/>
+                <conditional name="graph_con">
+                    <param name="graph_op" value="augref"/>
+                    <param name="augref_sample" value="New_Sample_Name"/>
+                    <param name="augref_segs" value="true"/>
+                </conditional>
+            </conditional>
+            <output name="output" ftype="vg">
+                <assert_contents>
+                    <has_size min="13000"/>
+                </assert_contents>
+            </output>
+            <output name="output_augref_segs" ftype="tabular">
+                <assert_contents>
+                    <has_n_lines n="2"/>
+                    <has_line line="x&#009;0&#009;346&#009;New_Sample_Name#0#x_1_alt&#009;.&#009;0&#009;0"/>
+                    <has_line line="x&#009;328&#009;1001&#009;New_Sample_Name#0#x_2_alt&#009;.&#009;0&#009;0"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test Output Path Data -->
+        <!-- Test 6: Run on a gbz graph. Output path data as list with their lengths -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="lengths"/>
+            </conditional>
+            <output name="output" ftype="tabular">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line line="s0#0#chr2#0&#009;10000"/>
+                    <has_line line="s1#1#chr2#0&#009;10000"/>
+                    <has_line line="s1#1#chr1#0&#009;10000"/>
+                    <has_line line="chr1&#009;10000"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 7: Run on a gbz graph. Output path data as list with their metadata -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="metadata"/>
+            </conditional>
+            <output name="output" ftype="tabular">
+                <assert_contents>
+                    <has_line line="#NAME&#009;SENSE&#009;SAMPLE&#009;HAPLOTYPE&#009;LOCUS&#009;PHASE_BLOCK&#009;SUBRANGE"/>
+                    <has_line line="s0#0#chr2#0&#009;HAPLOTYPE&#009;s0&#009;0&#009;chr2&#009;0&#009;NO_SUBRANGE"/>
+                    <has_line line="s1#1#chr2#0&#009;HAPLOTYPE&#009;s1&#009;1&#009;chr2&#009;0&#009;NO_SUBRANGE"/>
+                    <has_line line="s1#1#chr1#0&#009;HAPLOTYPE&#009;s1&#009;1&#009;chr1&#009;0&#009;NO_SUBRANGE"/>
+                    <has_line line="chr1&#009;GENERIC&#009;NO_SAMPLE_NAME&#009;NO_HAPLOTYPE&#009;chr1&#009;NO_PHASE_BLOCK&#009;NO_SUBRANGE"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 8: Run on a gbz graph. Output path data as list with their cyclicity -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="cyclicity"/>
+            </conditional>
+            <output name="output" ftype="tabular">
+                <assert_contents>
+                    <has_line line="s0#0#chr2#0&#009;directed-acyclic&#009;undirected-acyclic"/>
+                    <has_line line="s1#1#chr2#0&#009;directed-acyclic&#009;undirected-acyclic"/>
+                    <has_line line="s1#1#chr1#0&#009;directed-acyclic&#009;undirected-acyclic"/>
+                    <has_line line="chr1&#009;directed-acyclic&#009;undirected-acyclic"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 9: Run on a gbz graph. Output path data as coverage stats -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="coverage"/>
+            </conditional>
+            <output name="output" ftype="tabular">
+                <assert_contents>
+                    <has_line line="PathName&#009;0-0&#009;1-1&#009;2-2&#009;3-3&#009;4-4&#009;5-5&#009;6-6"/>
+                    <has_line line="s0#0#chr2#0&#009;10000&#009;10000&#009;10000&#009;9970&#009;9901&#009;9901&#009;9901"/>
+                    <has_line line="s1#1#chr2#0&#009;10000&#009;10000&#009;10000&#009;9929&#009;9901&#009;9901&#009;9901"/>
+                    <has_line line="s1#1#chr1#0&#009;10000&#009;10000&#009;10000&#009;9937&#009;9901&#009;9901&#009;9901"/>
+                    <has_line line="chr1&#009;10000&#009;10000&#009;10000&#009;10000&#009;9901&#009;9901&#009;9901"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 10: Run on a gbz graph. Output path data as fasta -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="fasta"/>
+            </conditional>
+            <output name="output" ftype="fasta">
+                <assert_contents>
+                    <has_line line=">s0#0#chr2#0"/>
+                    <has_line line=">s1#1#chr2#0"/>
+                    <has_line line=">s1#1#chr1#0"/>
+                    <has_line line=">chr1"/>
+                    <has_line line="ATACGCAGAAGTCAATTCTTGAAGTCAGAGCCGCTCGTGACCCTGGAATGCTCAGACTGTGTAGTTATTGTGTTAAAAAG"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 11: Run on a gbz graph. Output path data as GAM -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="gam"/>
+            </conditional>
+            <output name="output" ftype="gam">
+                <assert_contents>
+                    <has_size min="38000"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 12: Run on a gbz graph. Output path data as GAF -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="gaf"/>
+            </conditional>
+            <output name="output" ftype="gaf">
+                <assert_contents>
+                    <has_line line="@HD&#009;VN:Z:1.0"/>
+                    <has_text text="s0#0#chr2#0&#009;10000&#009;0&#009;10000&#009;+&#009;>557>558>559>560>561>562"/>
+                    <has_text text="s1#1#chr2#0&#009;10000&#009;0&#009;10000&#009;+&#009;>557>558>559>560>561>562"/>
+                    <has_text text="s1#1#chr1#0&#009;10000&#009;0&#009;10000&#009;+&#009;>1>2>3>4>5>6>7>8>9>10>11"/>
+                    <has_text text="chr1&#009;10000&#009;0&#009;10000&#009;+&#009;>1>2>3>4>5>6>7>8>9>10>11>12"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test Path Selection -->
+        <!-- Test 13: Run on a gbz graph. Select paths by file. Output path data as list -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="selection_con">
+                <param name="selector_op" value="file"/>
+                <param name="paths_file" value="input_path_list.txt"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="list"/>
+            </conditional>
+            <output name="output" ftype="tabular">
+                <assert_contents>
+                    <has_n_lines n="2"/>
+                    <has_line line="s0#0#chr2#0"/>
+                    <has_line line="s1#1#chr2#0" negate="true"/>
+                    <has_line line="chr1"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 14: Run on a gbz graph. Select paths by prefix and excluding a sample. Output path data as list -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="selection_con">
+                <param name="selector_op" value="prefix"/>
+                <param name="paths_by" value="s"/>
+            </conditional>
+            <param name="exclude_sample" value="s1"/>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="list"/>
+            </conditional>
+            <output name="output" ftype="tabular">
+                <assert_contents>
+                    <has_n_lines n="8"/>
+                    <has_text text="s0#" n="4"/>
+                    <has_text text="s2#" n="4"/>
+                    <has_text text="s1#" negate="true"/>
+                    <has_line line="chr1" negate="true"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 15: Run on a gbz graph. Select paths by sample. Output path data as list -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="selection_con">
+                <param name="selector_op" value="sample"/>
+                <param name="sample" value="s0"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="list"/>
+            </conditional>
+            <output name="output" ftype="tabular">
+                <assert_contents>
+                    <has_n_lines n="4"/>
+                    <has_text text="s0#" n="4"/>
+                    <has_line line="s1#1#chr2#0" negate="true"/>
+                    <has_line line="chr1" negate="true"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 16: Run on a gbz graph. Select paths by path sense. Output path data as list -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+            </conditional>
+            <conditional name="selection_con">
+                <param name="selector_op" value="sense"/>
+                <param name="generic_paths" value="true"/>
+                <param name="reference_paths" value="false"/>
+                <param name="haplotype_paths" value="false"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="list"/>
+            </conditional>
+            <output name="output" ftype="tabular">
+                <assert_contents>
+                    <has_n_lines n="2"/>
+                    <has_line line="s1#1#chr2#0" negate="true"/>
+                    <has_line line="chr1"/>
+                    <has_line line="chr2"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 17: Run on a vg graph with alts. Select paths by variants paths. Output path data as list -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="xy_with_alts.vg"/>
+            </conditional>
+            <conditional name="selection_con">
+                <param name="selector_op" value="alt"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="list"/>
+            </conditional>
+            <output name="output" ftype="tabular">
+                <assert_contents>
+                    <has_text text="_alt_"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test with GBWT Index -->
+        <!-- Test 18: Run on a gbz graph with a gbwt index. Output path data as list with their lengths -->
+        <test expect_num_outputs="1">
+            <conditional name="input_op">
+                <param name="xg" value="giraffe/graph.gbz"/>
+                <param name="gbwt" value="giraffe/graph.gbwt"/>
+            </conditional>
+            <conditional name="output_con">
+                <param name="type" value="data"/>
+                <param name="data_op" value="lengths"/>
+            </conditional>
+            <output name="output" ftype="tabular">
+                <assert_contents>
+                    <has_n_lines n="14"/>
+                    <has_line line="s0#0#chr2#0&#009;10000"/>
+                    <has_line line="s1#1#chr2#0&#009;10000"/>
+                    <has_line line="s1#1#chr1#0&#009;10000"/>
+                    <has_line line="chr1&#009;10000"/>
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help><![CDATA[
+vg paths can be used to extract and analyze paths in a variation graph. 
+Paths can be selected based on their names, prefixes, sample association, or sense. 
+The selected paths can then be extracted in different formats, or used to modify the graph.
+
+-----
+
+**Inputs**
+
+- **Graph for path operations**: The input graph in .vg, .xg, or .gbz format.
+- **GBWT index**: An optional GBWT index file. If provided, the tool will extract and operate on the threads within the GBWT index rather than the standard paths embedded in the main graph.
+
+.. class:: warningmark
+
+Using a GBWT index limits the tool functions. To prevent execution fails, the following options cannot be used when a GBWT index is provided:
+
+* **Under Path Selection:** "Variant paths" and "By path sense".
+* **Under Outputs (Graph):** "Drop selected paths", "Retain only selected paths", "Normalize paths", and "Compute augmented reference".
+* **Under Outputs (Path Data):** "Path metadata" and "Coverage statistics".
+
+-----
+
+**Path Selection**
+
+- **Default**: Selects all reference, haplotype, and generic paths in the graph without applying any additional filters.
+- **From file**: Provide a text file containing exactly one path name per line. Only exact matches are selected.
+- **By name prefix**: Select all paths whose names start with the specified text.
+- **By sample name**: Select all reference and haplotype paths associated with a specific sample (generic paths are ignored).
+- **By path sense**: Explicitly choose whether to include generic, reference, and/or haplotype paths (if none of them are selected, the tool reverts to its default behavior and selects all three).
+- **Variant paths**: Select paths representing alternative alleles (which are strictly generic paths). These are typically created using "vg construct -a".
+
+-----
+
+**Outputs**
+
+The tool can produce two main types of output:
+
+**Modified Graph (in .vg format)**:
+    - **Extract selected paths**: Outputs a new path-only graph consisting of the selected paths.
+    - **Drop selected paths**: Outputs a graph with the selected paths removed (requires a modifiable graph as input, e.g., .vg).
+    - **Retain only selected paths**: Outputs a graph that retains only the selected paths (requires a modifiable graph as input, e.g., .vg).
+    - **Normalize paths**: Merges equivalent paths within a site to simplify the graph structure (requires a modifiable graph as input, e.g., .vg).
+    - **Compute augmented reference**: Generates synthetic linear paths that cover the variations branching off a specified reference. ℹ️️ This requires to select "By name prefix" in the Path Selection step and a modifiable graph as input, e.g., .vg, otherwise the tool execution will fail.
+
+**Path Data**:
+    - **GAM/GAF alignments**: Extracts the selected paths as alignments in GAM or GAF format.
+    - **List of path names**: A simple text file with one path name per line.
+    - **Path lengths**: A table of path names and their lengths in base pairs.
+    - **Path metadata**: A table including path name, sense, sample, haplotype, locus, phase block, and subrange.
+    - **Path cyclicity**: A table indicating whether each path is cyclic.
+    - **FASTA sequences**: The sequences of the selected paths in FASTA format.
+    - **Coverage statistics**: A table calculating the coverage statistics for the selected paths.
+
+-----
+
+**Read More**
+
+    - General vg Wiki: https://github.com/vgteam/vg/wiki/
+    ]]></help>
+    <citations>
+        <citation type="doi">10.1038/nbt.4227</citation>
+        <citation type="doi">10.1093/bioinformatics/btac656</citation>
+    </citations>
+    <creator>
+        <person givenName="Niklas" familyName="Mayle" url="https://github.com/Maed0x"/>
+        <person givenName="Saim" familyName="Momin" url="https://github.com/SaimMomin12"/>
+        <organization name="Galaxy Europe" url="https://galaxyproject.org/eu/"/>
+    </creator>
+</tool>
diff --git a/tools/vg/test-data/input_path_list.txt b/tools/vg/test-data/input_path_list.txt
new file mode 100644
index 00000000000..b4d0994ead1
--- /dev/null
+++ b/tools/vg/test-data/input_path_list.txt
@@ -0,0 +1,2 @@
+s0#0#chr2#0
+chr1
\ No newline at end of file
diff --git a/tools/vg/test-data/xy_with_alts.vg b/tools/vg/test-data/xy_with_alts.vg
new file mode 100644
index 00000000000..67e72b2cde3
Binary files /dev/null and b/tools/vg/test-data/xy_with_alts.vg differ