Improve testing #1
Workflow file for this run
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| name: CI | |
| on: | |
| push: | |
| branches: [ main, develop ] | |
| pull_request: | |
| branches: [ main, develop ] | |
| workflow_dispatch: | |
| jobs: | |
| test: | |
| runs-on: ${{ matrix.os }} | |
| strategy: | |
| fail-fast: false | |
| matrix: | |
| os: [ubuntu-latest, macos-latest, windows-latest] | |
| python-version: ['3.10', '3.11', '3.12'] | |
| steps: | |
| - uses: actions/checkout@v4 | |
| - name: Set up Python ${{ matrix.python-version }} | |
| uses: actions/setup-python@v4 | |
| with: | |
| python-version: ${{ matrix.python-version }} | |
| - name: Cache pip dependencies | |
| uses: actions/cache@v3 | |
| with: | |
| path: ~/.cache/pip | |
| key: ${{ runner.os }}-pip-${{ hashFiles('**/requirements.txt', '**/setup.py') }} | |
| restore-keys: | | |
| ${{ runner.os }}-pip- | |
| - name: Install system dependencies (Ubuntu) | |
| if: matrix.os == 'ubuntu-latest' | |
| run: | | |
| sudo apt-get update | |
| sudo apt-get install -y build-essential | |
| - name: Install system dependencies (macOS) | |
| if: matrix.os == 'macos-latest' | |
| run: | | |
| brew install --quiet gcc || true | |
| - name: Install Python dependencies | |
| run: | | |
| python -m pip install --upgrade pip setuptools wheel | |
| pip install -e . | |
| pip install pytest pytest-cov coverage flake8 ruff | |
| - name: Install optional bioinformatics dependencies (Ubuntu) | |
| if: matrix.os == 'ubuntu-latest' | |
| run: | | |
| # Try to install optional dependencies, but don't fail if unavailable | |
| pip install pybedtools || echo "pybedtools unavailable, continuing..." | |
| # Note: ViennaRNA and pblat are complex to install in CI, tests handle graceful degradation | |
| - name: Install optional bioinformatics dependencies (macOS) | |
| if: matrix.os == 'macos-latest' | |
| run: | | |
| # Try to install optional dependencies, but don't fail if unavailable | |
| pip install pybedtools || echo "pybedtools unavailable, continuing..." | |
| - name: Lint with ruff | |
| run: | | |
| # Stop the build if there are Python syntax errors or undefined names | |
| ruff check baitUtils/ --select=E9,F63,F7,F82 --show-source --statistics | |
| # Exit-zero treats all errors as warnings | |
| ruff check baitUtils/ --exit-zero --statistics | |
| - name: Lint with flake8 | |
| run: | | |
| # Stop the build if there are Python syntax errors or undefined names | |
| flake8 baitUtils/ --count --select=E9,F63,F7,F82 --show-source --statistics | |
| # Exit-zero treats all errors as warnings. The GitHub editor is 127 chars wide | |
| flake8 baitUtils/ --count --exit-zero --max-complexity=10 --max-line-length=127 --statistics | |
| - name: Test import functionality | |
| run: | | |
| python -c "import baitUtils; print('✓ Main package imports successfully')" | |
| python -c "from baitUtils.sequence_analysis import SequenceAnalyzer; print('✓ Core modules import successfully')" | |
| python -c "from baitUtils.sequence_statistics import SequenceStatsCalculator; print('✓ Statistics modules import successfully')" | |
| python -c "from baitUtils.plotting_utils import StatisticalPlotter; print('✓ Plotting modules import successfully')" | |
| - name: Test CLI help commands | |
| run: | | |
| python -m baitUtils --help | |
| python -m baitUtils stats --help | |
| python -m baitUtils plot --help | |
| python -m baitUtils map --help | |
| python -m baitUtils check --help | |
| python -m baitUtils fill --help | |
| python -m baitUtils evaluate --help | |
| python -m baitUtils compare --help | |
| - name: Run unit tests with pytest | |
| run: | | |
| pytest tests/ -v --tb=short --strict-warnings | |
| - name: Run unit tests with unittest (fallback) | |
| if: failure() | |
| run: | | |
| python -m unittest discover tests/ -v | |
| - name: Test with coverage | |
| if: matrix.os == 'ubuntu-latest' && matrix.python-version == '3.12' | |
| run: | | |
| coverage run -m pytest tests/ | |
| coverage report -m | |
| coverage xml | |
| - name: Upload coverage to Codecov | |
| if: matrix.os == 'ubuntu-latest' && matrix.python-version == '3.12' | |
| uses: codecov/codecov-action@v3 | |
| with: | |
| file: ./coverage.xml | |
| flags: unittests | |
| name: codecov-umbrella | |
| fail_ci_if_error: false | |
| integration-test: | |
| runs-on: ubuntu-latest | |
| needs: test | |
| if: success() | |
| steps: | |
| - uses: actions/checkout@v4 | |
| - name: Set up Python 3.12 | |
| uses: actions/setup-python@v4 | |
| with: | |
| python-version: '3.12' | |
| - name: Install dependencies | |
| run: | | |
| python -m pip install --upgrade pip | |
| pip install -e . | |
| - name: Create test data | |
| run: | | |
| mkdir -p test_data | |
| cat > test_data/test_sequences.fasta << 'EOF' | |
| >seq1 | |
| ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG | |
| >seq2 | |
| GCTATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGAT | |
| >seq3 | |
| CGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC | |
| EOF | |
| - name: Test stats command | |
| run: | | |
| python -m baitUtils stats -i test_data/test_sequences.fasta -o test_output/ | |
| ls -la test_output/ | |
| test -f test_output/sequence_statistics.tsv | |
| - name: Test plot command (basic) | |
| run: | | |
| python -m baitUtils plot -i test_output/sequence_statistics.tsv -o test_plots/ | |
| ls -la test_plots/ | |
| - name: Clean up test data | |
| run: | | |
| rm -rf test_data/ test_output/ test_plots/ | |
| security-check: | |
| runs-on: ubuntu-latest | |
| steps: | |
| - uses: actions/checkout@v4 | |
| - name: Set up Python | |
| uses: actions/setup-python@v4 | |
| with: | |
| python-version: '3.12' | |
| - name: Install security tools | |
| run: | | |
| python -m pip install --upgrade pip | |
| pip install safety bandit | |
| - name: Run safety check | |
| run: | | |
| pip freeze | safety check --stdin || echo "Safety check completed with warnings" | |
| - name: Run bandit security lint | |
| run: | | |
| bandit -r baitUtils/ -f json -o bandit-report.json || echo "Bandit completed with findings" | |
| bandit -r baitUtils/ || echo "Bandit security check completed" | |
| documentation-check: | |
| runs-on: ubuntu-latest | |
| steps: | |
| - uses: actions/checkout@v4 | |
| - name: Set up Python | |
| uses: actions/setup-python@v4 | |
| with: | |
| python-version: '3.12' | |
| - name: Check README exists | |
| run: | | |
| test -f README.md | |
| echo "✓ README.md exists" | |
| - name: Check CLAUDE.md is up to date | |
| run: | | |
| test -f CLAUDE.md | |
| echo "✓ CLAUDE.md exists" | |
| - name: Check CONTRIBUTING.md exists | |
| run: | | |
| test -f CONTRIBUTING.md | |
| echo "✓ CONTRIBUTING.md exists" | |
| - name: Validate package structure | |
| run: | | |
| python -c " | |
| import os | |
| required_files = [ | |
| 'baitUtils/__init__.py', | |
| 'baitUtils/__main__.py', | |
| 'baitUtils/_version.py', | |
| 'setup.py', | |
| 'requirements.txt' | |
| ] | |
| for f in required_files: | |
| assert os.path.exists(f), f'Missing required file: {f}' | |
| print('✓ All required package files exist') | |
| " | |
| - name: Check version consistency | |
| run: | | |
| python -c " | |
| import sys | |
| sys.path.insert(0, '.') | |
| from baitUtils._version import __version__ | |
| print(f'Package version: {__version__}') | |
| assert __version__.strip(), 'Version string is empty' | |
| print('✓ Version is properly defined') | |
| " |